View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0684_low_92 (Length: 267)
Name: NF0684_low_92
Description: NF0684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0684_low_92 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 12 - 257
Target Start/End: Complemental strand, 36056206 - 36055961
Alignment:
| Q |
12 |
ataatactaactattaagtaaaaaacggtgtccaaaatgtctatcccttccgaccatactcaagagggggtacctcagggttcaatgtaagagttgcaaa |
111 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36056206 |
ataatactatttattaagtaaaaattggtgtccaaaacgtctatcccttccgtccatactcaagagggggtacctcagggttcaatgtaagagttgcaaa |
36056107 |
T |
 |
| Q |
112 |
ggcaattatactactgcttgaactagtatatgggcttaaaggtagaaattcacaagtatttacttgttcgtgtaatttaaattcgtcatgctgctaattt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36056106 |
ggcaattatactactgcttgaactagtatatgggcttaaaggtagaaattcacaaggatttacttgttcgtgtaatttaaattcgtcatgctgctaattt |
36056007 |
T |
 |
| Q |
212 |
ggtattaaagtttgtccgacaatggggtttggggatgtttaagatg |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36056006 |
ggtattaaagtttgtccgacaatggggtttggggatgtttaagatg |
36055961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University