View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686-Insertion-11 (Length: 159)
Name: NF0686-Insertion-11
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686-Insertion-11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 5e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 8 - 159
Target Start/End: Complemental strand, 49461412 - 49461262
Alignment:
| Q |
8 |
aaaaatgtatctgcattttttatttgaaaatccagagctcatgcatgattatagattctgggcaataatttattctcttgttggacttgggaatgtaagt |
107 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49461412 |
aaaaatgtatctgcattttt-atttgaaaatccagagctcatgcatgattatagattctgggcaataatttattctcttgttggacttgggaatgtaagt |
49461314 |
T |
 |
| Q |
108 |
ttttgactataaaacttttaagaaagtcgctagaaatatcaacaacttacca |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49461313 |
ttttgactataaaacttttaagaaagtcgctagaaatatcaacaacttacca |
49461262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University