View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686-Insertion-12 (Length: 115)
Name: NF0686-Insertion-12
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686-Insertion-12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 5e-38; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 5e-38
Query Start/End: Original strand, 8 - 115
Target Start/End: Complemental strand, 25713623 - 25713517
Alignment:
| Q |
8 |
atatgaataccctcattccgaattgataaactataaactttgttttaaactcaagtcgcatttatgaggtattgtctgctttaaagttttgcgcaaagtt |
107 |
Q |
| |
|
||||||| |||||||||| ||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
25713623 |
atatgaaaaccctcattctgaattgacaaactataaactttgttttgaactcaagtcgcatttatgaggtattgtctgctttaaa-ttttgtgcaaagtt |
25713525 |
T |
|
| Q |
108 |
ttcacgat |
115 |
Q |
| |
|
|||||||| |
|
|
| T |
25713524 |
ttcacgat |
25713517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1018 times since January 2019
Visitors: 4362