View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0686-Insertion-12 (Length: 115)

Name: NF0686-Insertion-12
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0686-Insertion-12
NF0686-Insertion-12
[»] chr4 (1 HSPs)
chr4 (8-115)||(25713517-25713623)


Alignment Details
Target: chr4 (Bit Score: 80; Significance: 5e-38; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 5e-38
Query Start/End: Original strand, 8 - 115
Target Start/End: Complemental strand, 25713623 - 25713517
Alignment:
8 atatgaataccctcattccgaattgataaactataaactttgttttaaactcaagtcgcatttatgaggtattgtctgctttaaagttttgcgcaaagtt 107  Q
    ||||||| |||||||||| ||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||||    
25713623 atatgaaaaccctcattctgaattgacaaactataaactttgttttgaactcaagtcgcatttatgaggtattgtctgctttaaa-ttttgtgcaaagtt 25713525  T
108 ttcacgat 115  Q
    ||||||||    
25713524 ttcacgat 25713517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1018 times since January 2019
Visitors: 4362