View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686-Insertion-13 (Length: 108)
Name: NF0686-Insertion-13
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686-Insertion-13 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 3e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 3e-48
Query Start/End: Original strand, 8 - 108
Target Start/End: Complemental strand, 15201620 - 15201520
Alignment:
| Q |
8 |
aaaagcagggacaatatcaaccatagctgaagccaaagtgggagaactgaatctaattccagaagccattaacgtctgagttgcagttctgcacatgtag |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15201620 |
aaaagcagggacaatatcaaccatagctgaagccaaagtaggagaactgaatctaattccagaagccattaacgtctgagttgcagttctgcacatgtag |
15201521 |
T |
 |
| Q |
108 |
g |
108 |
Q |
| |
|
| |
|
|
| T |
15201520 |
g |
15201520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 2e-28
Query Start/End: Original strand, 8 - 107
Target Start/End: Complemental strand, 15208567 - 15208468
Alignment:
| Q |
8 |
aaaagcagggacaatatcaaccatagctgaagccaaagtgggagaactgaatctaattccagaagccattaacgtctgagttgcagttctgcacatgtag |
107 |
Q |
| |
|
|||||||||||||| || ||| |||||||||||||| | |||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
15208567 |
aaaagcagggacaagattaacaatagctgaagccaacgcaggagaactgaatttaattccagaagtcattaacgtctgagttgcagttctgcacaagtag |
15208468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University