View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_high_12 (Length: 306)
Name: NF0686_high_12
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 29 - 294
Target Start/End: Original strand, 32499331 - 32499596
Alignment:
| Q |
29 |
aatggcagcatcttctttttgcttgagcaacacttccttccccttcttttgatcattattttattttatggcaacctcagaaaagtctctatctttgata |
128 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32499331 |
aatggcagcatcatctttttgcttgagcaacacttccttccccttctttttatcattgttttattttatggcaacctttgaaaagtctctatctttgata |
32499430 |
T |
|
| Q |
129 |
gtattatgcttctcattctcaatttaactagacacatttctttttaaattatacatgcatatactttgtagtgaatattctaaaaatagtaacattgttt |
228 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32499431 |
gtattatgctgctcattctcaatttaactagacacatttctttttaaattatacattcatatactttgtagtgaatattctaaaaatagtaacattgttt |
32499530 |
T |
|
| Q |
229 |
tgacttttgagtacaaattaatcatcattcaaataataaaacaattaagtttaagcaatatatatt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32499531 |
tgacttttgagtacaaattaatcatcattcaaataataaaacaattaagtttaagcaatatatatt |
32499596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1077 times since January 2019
Visitors: 4402