View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_high_18 (Length: 274)
Name: NF0686_high_18
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0686_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 139 - 239
Target Start/End: Original strand, 21013458 - 21013558
Alignment:
Q |
139 |
tcttgagacaatttcgtccacaaccattaacaggagcatcctcatccttttgataattcgaaacaaccgtcggaaccctcttaatactcaacatcttctc |
238 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21013458 |
tcttgagacaatttcgtccacaaccattaacaggagcatcctcatccttttgataattcgaaacaaccgtcggaaccctcttaatactcaacatcttctc |
21013557 |
T |
 |
Q |
239 |
t |
239 |
Q |
|
|
| |
|
|
T |
21013558 |
t |
21013558 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University