View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_high_20 (Length: 264)
Name: NF0686_high_20
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 43 - 250
Target Start/End: Original strand, 31051592 - 31051799
Alignment:
| Q |
43 |
gtaataggagtgtaattcttaaaaacagattggagcaagattattttggggctacttgcttgtgcatgacgaatttgcctctgacaatcaatacgatgtt |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31051592 |
gtaataggagtgtaattcttaaaaacagattggagcaagattattttggggctacttgcttgtgcatgaggaatttgcctctgacaatcaatacgatgtt |
31051691 |
T |
|
| Q |
143 |
tttatttatgtaaaaattaagtaaatactcaacctgttacatggaactttctttgaccctcttagtttgttaatttgacagatgtttcccccacgccatt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31051692 |
tttatttatgtaaaaattaagtaaatactcaacctgttacatggaactttctttgaacctcttagtttgttaatttgacagatgtttcccccacgccatt |
31051791 |
T |
|
| Q |
243 |
ttgttgga |
250 |
Q |
| |
|
||| |||| |
|
|
| T |
31051792 |
ttgctgga |
31051799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 173 - 250
Target Start/End: Original strand, 31064138 - 31064215
Alignment:
| Q |
173 |
aacctgttacatggaactttctttgaccctcttagtttgttaatttgacagatgtttcccccacgccattttgttgga |
250 |
Q |
| |
|
||||||||||| ||||||||||| || ||||| ||||||||||||||||||| || |||||||||||||||| |||| |
|
|
| T |
31064138 |
aacctgttacaaggaactttcttagaacctctgagtttgttaatttgacagacattacccccacgccattttgctgga |
31064215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 206 - 243
Target Start/End: Original strand, 31110968 - 31111005
Alignment:
| Q |
206 |
agtttgttaatttgacagatgtttcccccacgccattt |
243 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
31110968 |
agtttgtcaagttgacagatgtttcccccacgccattt |
31111005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1336 times since January 2019
Visitors: 4413