View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_high_21 (Length: 261)
Name: NF0686_high_21
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0686_high_21 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 29 - 261
Target Start/End: Complemental strand, 54701939 - 54701707
Alignment:
Q |
29 |
actgtggactcatttttcattgctttcaagtttccaagtgcctttgcaatagctttcttcatcttcttcctatatgacaagtattttccttccaccctca |
128 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54701939 |
actgtggactcatttttcattgctttcaagtttccaagtgcctctgcaatagctttcttcatcttcttcctatatgacaagtattttccttccaccctca |
54701840 |
T |
 |
Q |
129 |
actgtgattccactttccacagctctcctcctgagaataactgaccgtagttcatgcatgatatcctttgattgcaccatacaatctttaactagatcca |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54701839 |
actgtgattccactttccacagctctcctcctgagaataactgaccttagttcatgcatgatatcctttgattgcaccatacaatctttaactagatcca |
54701740 |
T |
 |
Q |
229 |
tcaaatagttcatcaacttgtttctcgctgcct |
261 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
54701739 |
tcaaatagttcatcaacttgtttctcgctgcct |
54701707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1628 times since January 2019
Visitors: 4425