View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_high_9 (Length: 380)
Name: NF0686_high_9
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 29 - 371
Target Start/End: Original strand, 18784194 - 18784534
Alignment:
| Q |
29 |
aggtttaattatagtgattttatttagtctataactttaaagttgatataatgattctgattttgattctatttgcttgcttgcagctcttgcatatttg |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18784194 |
aggtttaattatagtgattttatttagtctataactttaaagttgatataatgattctgattttgattctatttgcttgcttgtagctcttgcatatttg |
18784293 |
T |
|
| Q |
129 |
gttgttgagggaatatcttgagatagaaatgaagatagaagatcctcccaaaaacttcgtctttgatcttgagcggattgttgatgattttatcttcatt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18784294 |
gttgttgagggaatatcttgagatagaaatgaagatagaagatcctcccaaaaacttcgtctttgatcttgagcggattgttgatgattttatcttcatt |
18784393 |
T |
|
| Q |
229 |
tgtttcttttctggaaatgattttctgcctcacttgccgtctttgtatattcacgaggtatttactaacattttttcctttagttttataagttcaatat |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
18784394 |
tgtttcttttctggaaatgattttctgcctcacttgccgtctttgtatattcatgaggtatttagtaacattttttcctttagttttataagttca--at |
18784491 |
T |
|
| Q |
329 |
atatatagatcacttatgcttaattgtttggctccatattatt |
371 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
18784492 |
atatatagatcacttatgtttaattgtttggttccattttatt |
18784534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 116 - 266
Target Start/End: Original strand, 22872982 - 22873132
Alignment:
| Q |
116 |
tcttgcatatttggttgttgagggaatatcttgagatagaaatgaagatagaagatcctcccaaaaacttcgtctttgatcttgagcggattgttgatga |
215 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || ||||| ||| |||||||||||||| |||| |||||||| |
|
|
| T |
22872982 |
tcttgcatatttggttgttgaaggaatatcttgagatagaaatgaagatagaagatcttctaaaaaatttcatctttgatcttgagaggatagttgatga |
22873081 |
T |
|
| Q |
216 |
ttttatcttcatttgtttcttttctggaaatgattttctgcctcacttgcc |
266 |
Q |
| |
|
|||||||||||||| ||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
22873082 |
ttttatcttcatttttttttttgctggaaatgattttctgcctcacttgcc |
22873132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 576 times since January 2019
Visitors: 4387