View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_low_11 (Length: 416)
Name: NF0686_low_11
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 8e-71; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 18185570 - 18185721
Alignment:
| Q |
1 |
tttatttagtattaaattttatttttgctattatgaacgttgagttgtattagtacattttgtgatattcttattataattttattgaaatgactattga |
100 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18185570 |
tttatttagtattaatttttttttttgctattatgaatgttgagttgtattagtacattttgtgatattcttattataattttattgaaatgactattga |
18185669 |
T |
|
| Q |
101 |
gttgtagtaatacattttccgagattgattatatttttacggagtattctga |
152 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18185670 |
gttgtagtagtacattttccgagattgattatatttttacggagtattctga |
18185721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 52 - 116
Target Start/End: Complemental strand, 35789628 - 35789564
Alignment:
| Q |
52 |
agtacattttgtgatattcttattataattttattgaaatgactattgagttgtagtaatacatt |
116 |
Q |
| |
|
|||||||||||||||| ||| |||||| |||||||||||||| |||||||||||| || |||||| |
|
|
| T |
35789628 |
agtacattttgtgatactctaattatatttttattgaaatgaatattgagttgtattagtacatt |
35789564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 241 - 285
Target Start/End: Complemental strand, 35789437 - 35789393
Alignment:
| Q |
241 |
gttatttccgtccgaaatgtgtaggaaattttaacttaattccgt |
285 |
Q |
| |
|
|||| ||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
35789437 |
gttaattccgtccgaaattcgtaggaagttttaacttaattccgt |
35789393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 246 - 282
Target Start/End: Complemental strand, 8513128 - 8513092
Alignment:
| Q |
246 |
ttccgtccgaaatgtgtaggaaattttaacttaattc |
282 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8513128 |
ttccgtccgaaatccgtaggaaattttaacttaattc |
8513092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 761 times since January 2019
Visitors: 4393