View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0686_low_13 (Length: 401)

Name: NF0686_low_13
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0686_low_13
NF0686_low_13
[»] chr3 (1 HSPs)
chr3 (53-401)||(36262421-36262769)
[»] chr5 (1 HSPs)
chr5 (146-248)||(37062404-37062506)


Alignment Details
Target: chr3 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 53 - 401
Target Start/End: Complemental strand, 36262769 - 36262421
Alignment:
53 aaactttgtaactttggattagcaagagtggtagatgattacgattttggtgaagaggggttccaatttacaaggcatgttgttggcactcatggttaca 152  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36262769 aaactttgtaactttggattagcaagagtggtagatgattacgattttggtgaagaggggttccaatttacaaggcatgttgttggcactcatggttaca 36262670  T
153 tgccacctgagtatatcgagaacggtttggttagtccaaagatggatgtttttgcttttggtgttgtgatgttggagcttctttcaggaagagaagcaat 252  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
36262669 tgccacctgagtatatcgagaacggtttggttagtccaaagatggatgtttttgcttttggtgttgtgatgttggagcttctttcgggaagagaagcaat 36262570  T
253 tgttggtgacaaaaatggaggagagaagcggctatcagctgtcgtgagtgaagtacttgaaggcgataatgtgagggagaaatttcatgctttcatggat 352  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
36262569 tgttggtgacaaaaatggaggagagaagcggctatcagctgtcgtgagtgaagtacttgaaggcgataatgtgagggagaaacttcatgctttcatggat 36262470  T
353 ccaactttgaggggtgaatacccattgaatatggcatattccatggcag 401  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||    
36262469 ccaactttgaggggtgaatacccattgaatatgggatattccatggcag 36262421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 146 - 248
Target Start/End: Original strand, 37062404 - 37062506
Alignment:
146 ggttacatgccacctgagtatatcgagaacggtttggttagtccaaagatggatgtttttgcttttggtgttgtgatgttggagcttctttcaggaagag 245  Q
    ||||||||| |||| |||||||||||||| |||||| ||| ||||||||||||||||||||| |||||||||||||| |||||||||||||| || ||||    
37062404 ggttacatggcaccggagtatatcgagaatggtttgattactccaaagatggatgtttttgcatttggtgttgtgattttggagcttctttctggtagag 37062503  T
246 aag 248  Q
    |||    
37062504 aag 37062506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 930 times since January 2019
Visitors: 4397