View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_low_20 (Length: 319)
Name: NF0686_low_20
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686_low_20 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 79 - 319
Target Start/End: Original strand, 21445159 - 21445387
Alignment:
| Q |
79 |
cagagaggattggatcagctgaactatgctttcctaatgcaggaatactaagagaacgttttcttaatttggctctaccatttgatgatagtttcttctc |
178 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21445159 |
cagaaaggattggatcagctgaactatgctttcctaatgcaggaatactaagagaacgttttcttaatttggctctaccatttgatgatagtttcttctc |
21445258 |
T |
|
| Q |
179 |
actcttttcagcaagtaacgaaggataagcgcaaaagggttcttgagatgccactgctattggcaccgctattggcaccggctcacttctagttctaagg |
278 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21445259 |
actcttttctgcaagtaacgaaggataagcgcaaaagggttcttgagatgccact------------gctattggcaccggctcacttctagttctaagg |
21445346 |
T |
|
| Q |
279 |
aattggtcgagattttggcggtatttaatcccatggatttt |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21445347 |
aattggtcgagattttggcggtatttaatcccatggatttt |
21445387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 896 times since January 2019
Visitors: 4397