View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_low_21 (Length: 318)
Name: NF0686_low_21
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 61 - 205
Target Start/End: Complemental strand, 25690520 - 25690376
Alignment:
| Q |
61 |
gatatagaatggtttgatgtagaagagacgtgatgattatggtttgatgtgggatgggaactatatactatctgatggagctttgccaagatatgtgaca |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25690520 |
gatatagaatggtttgatgtagaagagacgtgatgattatggtttgatgtgggatgggaactatatactatctgatggagctttgccaagatatgtgaca |
25690421 |
T |
 |
| Q |
161 |
aagaaagagaaagctagagatggaaaaattaatacacgtcaactg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25690420 |
aagaaagagaaagctagagatggaaaaattaatacacgtcaactg |
25690376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 236 - 287
Target Start/End: Complemental strand, 25690345 - 25690294
Alignment:
| Q |
236 |
ggtgcagaattttaggttaactttcaagaaatgtagataatttaaagatagt |
287 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25690345 |
ggtgcagaattttaggttatctttcaagaaatgtagataatttaaagatagt |
25690294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University