View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0686_low_21 (Length: 318)

Name: NF0686_low_21
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0686_low_21
NF0686_low_21
[»] chr1 (2 HSPs)
chr1 (61-205)||(25690376-25690520)
chr1 (236-287)||(25690294-25690345)


Alignment Details
Target: chr1 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 61 - 205
Target Start/End: Complemental strand, 25690520 - 25690376
Alignment:
61 gatatagaatggtttgatgtagaagagacgtgatgattatggtttgatgtgggatgggaactatatactatctgatggagctttgccaagatatgtgaca 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25690520 gatatagaatggtttgatgtagaagagacgtgatgattatggtttgatgtgggatgggaactatatactatctgatggagctttgccaagatatgtgaca 25690421  T
161 aagaaagagaaagctagagatggaaaaattaatacacgtcaactg 205  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
25690420 aagaaagagaaagctagagatggaaaaattaatacacgtcaactg 25690376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 236 - 287
Target Start/End: Complemental strand, 25690345 - 25690294
Alignment:
236 ggtgcagaattttaggttaactttcaagaaatgtagataatttaaagatagt 287  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||    
25690345 ggtgcagaattttaggttatctttcaagaaatgtagataatttaaagatagt 25690294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University