View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_low_24 (Length: 310)
Name: NF0686_low_24
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 99 - 129
Target Start/End: Original strand, 47031809 - 47031839
Alignment:
| Q |
99 |
agatcccctgtagtgtcagtgttgataccac |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
47031809 |
agatcccctgtagtgtcagtgttgataccac |
47031839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1239 times since January 2019
Visitors: 4365