View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0686_low_24 (Length: 310)

Name: NF0686_low_24
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0686_low_24
NF0686_low_24
[»] chr7 (1 HSPs)
chr7 (99-129)||(47031809-47031839)


Alignment Details
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 99 - 129
Target Start/End: Original strand, 47031809 - 47031839
Alignment:
99 agatcccctgtagtgtcagtgttgataccac 129  Q
    |||||||||||||||||||||||||||||||    
47031809 agatcccctgtagtgtcagtgttgataccac 47031839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University