View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_low_25 (Length: 306)
Name: NF0686_low_25
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 9 - 266
Target Start/End: Complemental strand, 38700601 - 38700345
Alignment:
| Q |
9 |
gaagaatatatagatgaatttaacaagttcaaggcagattgtggtgttaaggaggaggttatgtgaatattaagcttcttttatgtttttctatctttgt |
108 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38700601 |
gaagaatatatagatgaagttaacaagttcaaggcagattgtggtgttaaggaggaggttatgtgaatattaagcttcttttatgtttttct--ctttgt |
38700504 |
T |
 |
| Q |
109 |
ggataaaacatcttata-atacagtttcactgcaggtaatagagttattgttagttccgaagccatcaattgagaaacgaaacaaacttctaaagcaaat |
207 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38700503 |
ggataaaacatcttatacatacagttttgctgcaggtaatagagttattgttagttccgaagccatcaattgagaaacgaaacaaacttataaagcaaat |
38700404 |
T |
 |
| Q |
208 |
agccgatcggtttgggtttaactggggtccaatttcagttatagacaatgcgtcttctg |
266 |
Q |
| |
|
|||| ||||||||| ||||||||||| |||||| || |||||| ||||||||||||||| |
|
|
| T |
38700403 |
agccaatcggtttgtgtttaactgggatccaatctctgttataaacaatgcgtcttctg |
38700345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University