View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_low_27 (Length: 300)
Name: NF0686_low_27
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0686_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 78 - 236
Target Start/End: Original strand, 51008498 - 51008660
Alignment:
Q |
78 |
ataagcaactttgtttctacttgatttgcttagataatatttttggtata----agctgttttatgtatgcatatgatctaaatattttgatgatgatga |
173 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51008498 |
ataagcaaatttgtttctacttgatttgcttagataatatttttggtatatataagctgttttatgtatgcatatgatctaaatattttgatgatgatga |
51008597 |
T |
 |
Q |
174 |
ttcagttaactattgctgttatttaagcttattgtatgaatataaagaataaattctactgat |
236 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51008598 |
ttcagttaactattgctgtcatttaagcttattgtatgaatataaagaataaattctactgat |
51008660 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University