View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_low_37 (Length: 274)
Name: NF0686_low_37
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 139 - 239
Target Start/End: Original strand, 21013458 - 21013558
Alignment:
| Q |
139 |
tcttgagacaatttcgtccacaaccattaacaggagcatcctcatccttttgataattcgaaacaaccgtcggaaccctcttaatactcaacatcttctc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21013458 |
tcttgagacaatttcgtccacaaccattaacaggagcatcctcatccttttgataattcgaaacaaccgtcggaaccctcttaatactcaacatcttctc |
21013557 |
T |
 |
| Q |
239 |
t |
239 |
Q |
| |
|
| |
|
|
| T |
21013558 |
t |
21013558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University