View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0686_low_37 (Length: 274)

Name: NF0686_low_37
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0686_low_37
NF0686_low_37
[»] chr3 (1 HSPs)
chr3 (139-239)||(21013458-21013558)


Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 139 - 239
Target Start/End: Original strand, 21013458 - 21013558
Alignment:
139 tcttgagacaatttcgtccacaaccattaacaggagcatcctcatccttttgataattcgaaacaaccgtcggaaccctcttaatactcaacatcttctc 238  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21013458 tcttgagacaatttcgtccacaaccattaacaggagcatcctcatccttttgataattcgaaacaaccgtcggaaccctcttaatactcaacatcttctc 21013557  T
239 t 239  Q
    |    
21013558 t 21013558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1354 times since January 2019
Visitors: 4368