View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_low_38 (Length: 268)
Name: NF0686_low_38
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 47 - 244
Target Start/End: Original strand, 21562310 - 21562504
Alignment:
| Q |
47 |
atttcctcaccagtaaagtaagattactttggttttatccgaaaaatgataatttatgggtccgaaacaattatcttgcttatgtatgattattagtgtg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21562310 |
atttcctcaccagtaaagtaagattactttggttttatccgaaaaatgataatttatgggtccgaagcaattatcttgcttatgtatgattattagtgtg |
21562409 |
T |
|
| Q |
147 |
ctggatccaaataataaccgtagtctaattcaataaaatcgaagaagttttcatcattaaaaagtaaccattcattaattagaatgtttttcatctca |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21562410 |
ctggatccaaataataaccgtagtctaattcaataaaatc---gaagttttcatcattaaaaagtaaccattcattaattagaatgtttttcatctca |
21562504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1478 times since January 2019
Visitors: 4416