View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_low_39 (Length: 268)
Name: NF0686_low_39
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686_low_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 31 - 169
Target Start/End: Original strand, 36167202 - 36167340
Alignment:
| Q |
31 |
attatactttggattcatatattcattccttccctcttgactttgaatttgaaatccatgcactttcggtaaaatgcgtatgaaaaaggctacattatac |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36167202 |
attatactttggattcatatattcattccttccctcttgactttgaatgtgaaatccatgcactttcggtaaaatgcgtatgaaaaaggctacattatac |
36167301 |
T |
|
| Q |
131 |
atttggatacctgcacgtaaactaatgcctgcatcaata |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36167302 |
atttggatacctgcacgtaaactaatgcctgcatcaata |
36167340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 190 - 231
Target Start/End: Original strand, 36167366 - 36167407
Alignment:
| Q |
190 |
atgatatggggcaatgactattctagagaggaatgatgatgt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36167366 |
atgatatggggcaatgactattctagagaggaatgatgatgt |
36167407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1380 times since January 2019
Visitors: 4368