View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_low_40 (Length: 267)
Name: NF0686_low_40
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686_low_40 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 39 - 237
Target Start/End: Original strand, 31051592 - 31051790
Alignment:
| Q |
39 |
gtaataggagtgtaattcttaaaaacagattggagcaagattattttggggctacttgcttgtgcatgacgaatttgcctctgacaatcaatacgatgtt |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31051592 |
gtaataggagtgtaattcttaaaaacagattggagcaagattattttggggctacttgcttgtgcatgaggaatttgcctctgacaatcaatacgatgtt |
31051691 |
T |
|
| Q |
139 |
tttatttatgtaaaaattaagtaaatactcaacctgttacatggaactttctttgaccctcttagtttgttaatttgacagatgtttcccccacgccat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31051692 |
tttatttatgtaaaaattaagtaaatactcaacctgttacatggaactttctttgaacctcttagtttgttaatttgacagatgtttcccccacgccat |
31051790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 169 - 237
Target Start/End: Original strand, 31064138 - 31064206
Alignment:
| Q |
169 |
aacctgttacatggaactttctttgaccctcttagtttgttaatttgacagatgtttcccccacgccat |
237 |
Q |
| |
|
||||||||||| ||||||||||| || ||||| ||||||||||||||||||| || |||||||||||| |
|
|
| T |
31064138 |
aacctgttacaaggaactttcttagaacctctgagtttgttaatttgacagacattacccccacgccat |
31064206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1462 times since January 2019
Visitors: 4416