View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_low_46 (Length: 257)
Name: NF0686_low_46
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 29 - 244
Target Start/End: Complemental strand, 39801145 - 39800930
Alignment:
| Q |
29 |
tcatcatagagatgtttttgttctttttgtaactattgtaaacggtgacacaagtaaacaaaccaaaaataaataccccagttcaagtctcgagtaacaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39801145 |
tcatcatagagatgtttttgttctttttgtgactattgtaaacggtgacacaagtaaacaaaccaaaaataaataccccagttcaagtctcgagtaacaa |
39801046 |
T |
 |
| Q |
129 |
gcttaggaaaaaagaagttgggtcagtgactacatttaccatacataattgctccaataaatgcatccccagcaccagtggtatcaataagctcagaatc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39801045 |
gcttaggaaaaaagaagttgggtcagtgactacacttaccatacataattgctccaataaatgcatccccagcaccagtggtatcaataagctcagaatc |
39800946 |
T |
 |
| Q |
229 |
tggtatcttctctgct |
244 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
39800945 |
aggtatcttctctgct |
39800930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 165 - 222
Target Start/End: Original strand, 29932343 - 29932400
Alignment:
| Q |
165 |
taccatacataattgctccaataaatgcatccccagcaccagtggtatcaataagctc |
222 |
Q |
| |
|
||||||| | || |||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29932343 |
taccatataaaactgctccaacaaatgcatccccagcaccagttgtatcaataagctc |
29932400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 222
Target Start/End: Original strand, 29925694 - 29925735
Alignment:
| Q |
181 |
tccaataaatgcatccccagcaccagtggtatcaataagctc |
222 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
29925694 |
tccaataaatgcatccccggcaccagtggtatcaacaagctc |
29925735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University