View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_low_47 (Length: 257)
Name: NF0686_low_47
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0686_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 6 - 244
Target Start/End: Complemental strand, 8687121 - 8686883
Alignment:
Q |
6 |
aaatacttatgctggtttaattttattattgagtattttcatgcgttggttaaggttaaataatctgaggacttctagctagccacatctcgatcgatta |
105 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8687121 |
aaatacttatgctggtttaattttattattgagtattttcatgcgttggttaaggttaaataatctgaggacttctagctagccacatctcgatcgatta |
8687022 |
T |
 |
Q |
106 |
ttgtatattgctacataaaatcttcttttctatatattagaatataaagtcttcaacgagtgcagggaaaatatttagtcttcaccaccttcgtgtattt |
205 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
8687021 |
ttgtatattgctacataaaatcttcttttctatatattagaatataaagtcttcaacgagtgcagggaaaatatttagtcttcactaccttcgtgtattt |
8686922 |
T |
 |
Q |
206 |
tgcatgaggtagtacatccaacaacattcccctcactct |
244 |
Q |
|
|
|||| ||||||| |||||||||||||||||||||||||| |
|
|
T |
8686921 |
tgcaagaggtagcacatccaacaacattcccctcactct |
8686883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 8675346 - 8675423
Alignment:
Q |
1 |
ttaataaatacttatgctggtttaattttat--tattgagtattttcatgcgttggttaaggttaaataatctgagga |
76 |
Q |
|
|
|||||||||| ||||| ||||||| |||||| ||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
T |
8675346 |
ttaataaatatttatgttggtttagttttatattatcgagtattttcgtgcgttggttaaggttaaatattctgagga |
8675423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University