View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_low_48 (Length: 251)
Name: NF0686_low_48
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686_low_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 7924496 - 7924254
Alignment:
| Q |
1 |
ctagtctgatttccgtcaaagacagatgtttctcgcctctactccttcgtacgatatatcattactcttattttgaatgataaatgcaattctcaattct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7924496 |
ctagtctgatttccgtcaaagacagatgtttctcgcctctactccttcgtacgatatcgcattactcttattttgaatgataaatgcaattctcaattct |
7924397 |
T |
|
| Q |
101 |
tcaatttctgtctctgggtcatacctatcataaaatcataaaaaat--atatatattacacaaacagaaatgcaagatgcttatttctaacaatttcaac |
198 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| | | | ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7924396 |
tcaatttctgtctctaggtcatacctatcataaaatcataaaaaataaaaaaacattacacaaacggaaatgcaagatgcttatttctaacaatttcaac |
7924297 |
T |
|
| Q |
199 |
aaaggatttagtcaacaaatcaatgaaatatgatggatattat |
241 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
7924296 |
aaaggatttggtcaacaaaacaatgaaatatgatggatattat |
7924254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 602 times since January 2019
Visitors: 4387