View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0686_low_49 (Length: 251)

Name: NF0686_low_49
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0686_low_49
NF0686_low_49
[»] chr7 (2 HSPs)
chr7 (1-90)||(5519581-5519670)
chr7 (130-241)||(5519710-5519824)


Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 5519581 - 5519670
Alignment:
1 aacaatactgaaaacgcatgcagtctacatatatctctttttaatattttgaaacaaacaaacaaactttttggtacatgaaaaaagaaa 90  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||    
5519581 aacaatactgaaaatgcatgcagtctacatatatctctttttaatatttggaaacaaacaaacaaactttttggcacatgaaaaaagaaa 5519670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 130 - 241
Target Start/End: Original strand, 5519710 - 5519824
Alignment:
130 ctaggtgattactataagttgctagcaacttagtacaaaattgaatgtgaacctgaaat---aatattatacactatggattattaggttggtgattatt 226  Q
    ||||||||||||||||||||||||||||||| |||||||||||||| ||| | ||||     |||||||||||||||||||||||||||||||| |||||    
5519710 ctaggtgattactataagttgctagcaacttggtacaaaattgaatatgatcatgaacctgaaatattatacactatggattattaggttggtggttatt 5519809  T
227 gatgggtggcctatg 241  Q
    |||||||||||||||    
5519810 gatgggtggcctatg 5519824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1334 times since January 2019
Visitors: 4413