View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_low_49 (Length: 251)
Name: NF0686_low_49
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 5519581 - 5519670
Alignment:
| Q |
1 |
aacaatactgaaaacgcatgcagtctacatatatctctttttaatattttgaaacaaacaaacaaactttttggtacatgaaaaaagaaa |
90 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5519581 |
aacaatactgaaaatgcatgcagtctacatatatctctttttaatatttggaaacaaacaaacaaactttttggcacatgaaaaaagaaa |
5519670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 130 - 241
Target Start/End: Original strand, 5519710 - 5519824
Alignment:
| Q |
130 |
ctaggtgattactataagttgctagcaacttagtacaaaattgaatgtgaacctgaaat---aatattatacactatggattattaggttggtgattatt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||| | |||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5519710 |
ctaggtgattactataagttgctagcaacttggtacaaaattgaatatgatcatgaacctgaaatattatacactatggattattaggttggtggttatt |
5519809 |
T |
 |
| Q |
227 |
gatgggtggcctatg |
241 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5519810 |
gatgggtggcctatg |
5519824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University