View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_low_50 (Length: 251)
Name: NF0686_low_50
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686_low_50 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 10 - 251
Target Start/End: Original strand, 54701445 - 54701682
Alignment:
| Q |
10 |
aagaatatctcaactactatgacgctaacttgtattctcatttcttagttatctttattttcagagaaaaacaatggcaggtgatgtagaaacgaacccc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54701445 |
aagaatatctcaactactatgacgctaacttgtattctcatttcttagttatctttattttcagagaaaaacaatggcaggtgatgtagaaacgaacccc |
54701544 |
T |
|
| Q |
110 |
aaaagctctctgcatagtcgcagcaacgactagcttaccctcggcatcacaccctaccgtatcacatcatcaataagtcacacactcgatgacttgcagg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54701545 |
aaaagctctctgcatagtcgcagcaacgactagcttaccctcggcatcacaccctaccgtatcacatcatcaataagtcacacactcgataacttgcagg |
54701644 |
T |
|
| Q |
210 |
atttgtataggcacatatatataagctactccacatgacaat |
251 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54701645 |
atttgtataggcac----atataagctactccacatgacaat |
54701682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 433 times since January 2019
Visitors: 4381