View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_low_59 (Length: 215)
Name: NF0686_low_59
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686_low_59 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 98 - 215
Target Start/End: Complemental strand, 20385295 - 20385178
Alignment:
| Q |
98 |
ttttttggttgtccaattgtgttgttgcaggttgctttttataggactgggattagggtttgtttaaaagaaacaaagaaaactgtatgccttgacttgg |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20385295 |
ttttctggttgtccaattgtgttgttgcaggttgctttttataggattgggattagggtttgtttaaaagaaacaaagaaaactgtatgccttgacttgg |
20385196 |
T |
 |
| Q |
198 |
ggaggaggaaagtgcgtc |
215 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
20385195 |
ggaggaggaaagtgcgtc |
20385178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 3e-22; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 112 - 192
Target Start/End: Original strand, 9019009 - 9019087
Alignment:
| Q |
112 |
aattgtgttgttgcaggttgctttttataggactgggattagggtttgtttaaaagaaacaaagaaaactgtatgccttga |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| || ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
9019009 |
aattgtgttgttgcaggttgctttttataggactgagatcagtgtttgtttaaaagaa--aaaaaaaactgtatgccttga |
9019087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 113 - 145
Target Start/End: Original strand, 3336089 - 3336121
Alignment:
| Q |
113 |
attgtgttgttgcaggttgctttttataggact |
145 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
3336089 |
attgtgttgttgcgggttgctttttataggact |
3336121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 108 - 157
Target Start/End: Original strand, 12369981 - 12370030
Alignment:
| Q |
108 |
gtccaattgtgttgttgcaggttgctttttataggactgggattagggtt |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||| ||||||| |
|
|
| T |
12369981 |
gtccaattgtgttgttgcaggttgctttttataggattaggagtagggtt |
12370030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 177 - 214
Target Start/End: Original strand, 19312956 - 19312993
Alignment:
| Q |
177 |
aaactgtatgccttgacttggggaggaggaaagtgcgt |
214 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
19312956 |
aaactgtatgccttggcttggggaggaggaaagcgcgt |
19312993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University