View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_low_60 (Length: 210)
Name: NF0686_low_60
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0686_low_60 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 15 - 188
Target Start/End: Complemental strand, 4610668 - 4610494
Alignment:
Q |
15 |
aattctgtaacattggtgcgtactaagttgaaagcatcagcctaataattgaatacatctaacaatttaaaaggcgcctatatttctagaccatgg-ttt |
113 |
Q |
|
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||| |
|
|
T |
4610668 |
aattctataacattggtgtgtactaagttgaaagcatcagcctaataattgaatacatttaacaatttaaaaggcgcttatatttctagaccatggtttt |
4610569 |
T |
 |
Q |
114 |
tatcttaatggttgcttacaaaacagtctcattctctttaactctggacttggtggaaatccagaatatgtaaca |
188 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
T |
4610568 |
tatcttaatggttgcttacaaaacagtctcattctctttaattcgggacttggtggaaatccagaatatgtaaca |
4610494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 131 - 188
Target Start/End: Complemental strand, 5108621 - 5108564
Alignment:
Q |
131 |
acaaaacagtctcattctctttaactctggacttggtggaaatccagaatatgtaaca |
188 |
Q |
|
|
||||||||||||||||| ||| || | |||| ||||||||||| |||||||||||||| |
|
|
T |
5108621 |
acaaaacagtctcattcacttcaattgtggagttggtggaaattcagaatatgtaaca |
5108564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University