View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0686_low_8 (Length: 452)
Name: NF0686_low_8
Description: NF0686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0686_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 339; Significance: 0; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 30 - 382
Target Start/End: Original strand, 30690076 - 30690430
Alignment:
| Q |
30 |
ggttgtggaacaaagagggacaactcctatgagtcatagtttctgttaatgttttttggtgtcttccccttcaaattattggtcaaaccccactgcaggt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30690076 |
ggttgtggaacaaagagggacaactcctatgagtcatagtttctgttaatgttttttggtgtcttccccttcaaattattggtcaaaccccactgcaggt |
30690175 |
T |
|
| Q |
130 |
tgtatcgaaattaatatatatatttgcctcaaattatggtaaccccactgcaggttgtattcaattatggatatggatttggattattctaatgtagcca |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30690176 |
tgtatcgaaattaatatatatatttgcctcaaattatggtaaccccactgcaggttgtattcaattatggatatggatttggattattctaatgtagcca |
30690275 |
T |
|
| Q |
230 |
gaaaaataatattatctattagtttagagagtttagtgctaataagaaacatagtttttgtcccaaaacaggttaagagaatctagatctaatatgctta |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30690276 |
gaaaaataatattatctattagtttagagagtttagtgctaataagaaacatagtttttgtcccaaaacaggttaagagaatctagatctaatatgctta |
30690375 |
T |
|
| Q |
330 |
ata-ttttttaggcaagatctaataagcttatgttactatataata-atatatat |
382 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30690376 |
atatttttttaggcaagatctaataagcttatgttactatataatatatatatat |
30690430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 203 - 321
Target Start/End: Original strand, 30672313 - 30672436
Alignment:
| Q |
203 |
tggatttggattattctaatgtagccagaaaaataata---ttatctatta---gtttagagagtttagtgctaataagaaacatagtttttgtcccaaa |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| ||||| ||| ||||| | |||||||||||| | ||| |||||||||||||| |
|
|
| T |
30672313 |
tggatttggattattctaatgtagccagaaaaataataacattatttattattagttaagagaatctagtgctaataaaacacactgtttttgtcccaaa |
30672412 |
T |
|
| Q |
297 |
acaggttaagagaatctagatctaa |
321 |
Q |
| |
|
||| ||||||||||||||||||||| |
|
|
| T |
30672413 |
aca-gttaagagaatctagatctaa |
30672436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 372 - 421
Target Start/End: Original strand, 30690451 - 30690500
Alignment:
| Q |
372 |
ataatatatatgtgctttgtcatgaacccctttaccttttcatattcttc |
421 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30690451 |
ataatatatatgtgctttgtcatgaacccctttaccttttcattttcttc |
30690500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 387 - 421
Target Start/End: Original strand, 30672731 - 30672765
Alignment:
| Q |
387 |
tttgtcatgaacccctttaccttttcatattcttc |
421 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
30672731 |
tttgtcatgaacccctttaccttttcatcttcttc |
30672765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 891 times since January 2019
Visitors: 4357