View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0687_high_10 (Length: 286)
Name: NF0687_high_10
Description: NF0687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0687_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 46 - 230
Target Start/End: Complemental strand, 30601183 - 30600999
Alignment:
| Q |
46 |
cagagacagcatgatgtcaggtcttattcttgaaaattgccctataagtttcacattccttttgaaccaggatcctctcgttcatgcacctccaatagca |
145 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30601183 |
cagatacagcatgatgtcaggccttattcttgaaaattgccctataagtttcacattccttttgaaccaggatcctctcgttcatgcacctccaatagca |
30601084 |
T |
|
| Q |
146 |
agaaaatcaggttgggatgagagaccgaaaaagaaactaagaaaaaacaataagtgagatagtcataacttagaattagatgatg |
230 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30601083 |
agaaaatcaggttgggatgagagacagaaaaagaaactaagaaaaaacaataagtgagatagtcataacttagaattagatgatg |
30600999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1515 times since January 2019
Visitors: 4421