View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0687_high_14 (Length: 247)

Name: NF0687_high_14
Description: NF0687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0687_high_14
NF0687_high_14
[»] chr1 (1 HSPs)
chr1 (55-161)||(49238091-49238197)


Alignment Details
Target: chr1 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 55 - 161
Target Start/End: Complemental strand, 49238197 - 49238091
Alignment:
55 agaaatagctgtggtcgagtatgattcgacccctgaatctgaagacgaagaggtgtgtgtggctgaacttgtgcaagggaagccctatgagtgcccagcg 154  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
49238197 agaaatagttgtggtcgagtatgattcgacccctgaatctgaagacgaagaggtgtgtgtggctgaacttgtgcaagggaagccctatgagtgtccagcg 49238098  T
155 ttaacca 161  Q
    |||||||    
49238097 ttaacca 49238091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University