View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0687_high_16 (Length: 212)

Name: NF0687_high_16
Description: NF0687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0687_high_16
NF0687_high_16
[»] chr5 (1 HSPs)
chr5 (1-198)||(14258128-14258325)


Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 14258325 - 14258128
Alignment:
1 ttcaccctctcttcttccaaacgcattctcttatcctcttcaataaaatcatcttccatcaatgaagtttcaatccacaacaattcagaatcagcttcca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14258325 ttcaccctctcttcttccaaacgcattctcttatcctcttcaataaaatcatcttccatcaatgaagtttcaatccacaacaattcagaatcagcttcca 14258226  T
101 atgcttctaacgagtttcttgacagaatacgcaaattggtttctttccttccttctattttccctggaggaacatggtggaacttctccgatgatgtc 198  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14258225 atgcttctgacgagtttcttgacagaatacgcaaattggtttctttccttccttctattttccctggaggaacatggtggaacttctccgatgatgtc 14258128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1834 times since January 2019
Visitors: 4432