View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0687_high_3 (Length: 382)
Name: NF0687_high_3
Description: NF0687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0687_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 119 - 353
Target Start/End: Complemental strand, 10536069 - 10535835
Alignment:
Q |
119 |
caagatctataacaccaattacagctaaactaaaattaaattaataaatcacnnnnnnncatgttggatctgataaaaactaacaattaacaattagaat |
218 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10536069 |
caagatctataacaccaattacagctaaactacaattaaattaataaatcacaaaaaaacatgttggatctgataaaaactaacaattaacaattagaat |
10535970 |
T |
 |
Q |
219 |
atacaaaatcataaagattactgattgtagaaatcacgtggatgagatctgagttgcaggagccggaaaatcaaaaatcaacagccgcatatagattcac |
318 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
10535969 |
atacaaaatcataaagattactgattgtagaaatcacgtggatgagatctgagttgcaggagccgaaaaatcaaaaatcaacagccgcatatagattcac |
10535870 |
T |
 |
Q |
319 |
cgcggtctccgattcagttgatgcaaggcgggatc |
353 |
Q |
|
|
||||| ||||||||||||||||||||||||||||| |
|
|
T |
10535869 |
cgcggcctccgattcagttgatgcaaggcgggatc |
10535835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 673 times since January 2019
Visitors: 4390