View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0687_high_7 (Length: 304)
Name: NF0687_high_7
Description: NF0687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0687_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 14 - 156
Target Start/End: Original strand, 30402716 - 30402858
Alignment:
Q |
14 |
atatatgccttgtagagtataatgatggagacagcgtgcgagttctgccttgcaatcatgaatttcatagaacatgcatagacaaatcgttgaaggagat |
113 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
30402716 |
atatatgccttgtagagtataatgatggagacagcgtgcgtgttctgccttgcaatcatgaatttcatagaacatgcatagacaaatggttgaaggagat |
30402815 |
T |
 |
Q |
114 |
tcacaggtatgagaaaatacatatccagatttcgttcttgttt |
156 |
Q |
|
|
||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
T |
30402816 |
tcacaggtatgagaaaatagatatccagatttccttcttgttt |
30402858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 14 - 124
Target Start/End: Complemental strand, 10784077 - 10783967
Alignment:
Q |
14 |
atatatgccttgtagagtataatgatggagacagcgtgcgagttctgccttgcaatcatgaatttcatagaacatgcatagacaaatcgttgaaggagat |
113 |
Q |
|
|
||||||||||||| ||||| | |||||||||||| ||||||| || ||||| ||||||||||||||| |||||| |||||||| | | |||| ||| | |
|
|
T |
10784077 |
atatatgccttgtggagtacgaagatggagacagcatgcgagtacttccttgtcatcatgaatttcatacaacatgtatagacaagtggctgaaagaggt |
10783978 |
T |
 |
Q |
114 |
tcacaggtatg |
124 |
Q |
|
|
||||||||||| |
|
|
T |
10783977 |
tcacaggtatg |
10783967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University