View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0687_low_28 (Length: 247)
Name: NF0687_low_28
Description: NF0687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0687_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 55 - 161
Target Start/End: Complemental strand, 49238197 - 49238091
Alignment:
Q |
55 |
agaaatagctgtggtcgagtatgattcgacccctgaatctgaagacgaagaggtgtgtgtggctgaacttgtgcaagggaagccctatgagtgcccagcg |
154 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
49238197 |
agaaatagttgtggtcgagtatgattcgacccctgaatctgaagacgaagaggtgtgtgtggctgaacttgtgcaagggaagccctatgagtgtccagcg |
49238098 |
T |
 |
Q |
155 |
ttaacca |
161 |
Q |
|
|
||||||| |
|
|
T |
49238097 |
ttaacca |
49238091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University