View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0687_low_29 (Length: 243)
Name: NF0687_low_29
Description: NF0687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0687_low_29 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 53 - 243
Target Start/End: Original strand, 31323555 - 31323745
Alignment:
Q |
53 |
aaaggggggaaggaatttgattctttacagccctttccagaccttatattatttccttcggttgggttcgctttttggtaggaaaggcggtagtagagtt |
152 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31323555 |
aaaggggggaaggaatttgattctttacagccctttccataccttatattatttccttcggttgggttcgctttttggtaggaaaggcggtagtagagtt |
31323654 |
T |
 |
Q |
153 |
gctagaggtccttcgcgtaattctactctttgttttccaggcagggacgcccatagttccctgctctaactcctctgatttccctttgctt |
243 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
T |
31323655 |
gctagaggtctttcgcgtaattctactctttgttttccaagcagggacgcccacagttccctgctctaactcctcagatttccctttgctt |
31323745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 33253031 - 33252969
Alignment:
Q |
1 |
ctcacacagctaggtttcgagagggctctatcgatctccggaacaggggaagaaaggggggaa |
63 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33253031 |
ctcacacagctaggtttcgagagggctctatcgatctccggaacaggggaagaaaggggggaa |
33252969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 85 - 128
Target Start/End: Complemental strand, 26350607 - 26350564
Alignment:
Q |
85 |
ctttccagaccttatattatttccttcggttgggttcgcttttt |
128 |
Q |
|
|
||||||| |||||||||||||||||| ||||||||||| ||||| |
|
|
T |
26350607 |
ctttccacaccttatattatttccttaggttgggttcgtttttt |
26350564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University