View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0687_low_31 (Length: 212)
Name: NF0687_low_31
Description: NF0687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0687_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 14258325 - 14258128
Alignment:
| Q |
1 |
ttcaccctctcttcttccaaacgcattctcttatcctcttcaataaaatcatcttccatcaatgaagtttcaatccacaacaattcagaatcagcttcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14258325 |
ttcaccctctcttcttccaaacgcattctcttatcctcttcaataaaatcatcttccatcaatgaagtttcaatccacaacaattcagaatcagcttcca |
14258226 |
T |
|
| Q |
101 |
atgcttctaacgagtttcttgacagaatacgcaaattggtttctttccttccttctattttccctggaggaacatggtggaacttctccgatgatgtc |
198 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14258225 |
atgcttctgacgagtttcttgacagaatacgcaaattggtttctttccttccttctattttccctggaggaacatggtggaacttctccgatgatgtc |
14258128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1118 times since January 2019
Visitors: 4402