View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0688_high_30 (Length: 307)
Name: NF0688_high_30
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0688_high_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 174 - 278
Target Start/End: Complemental strand, 42072635 - 42072531
Alignment:
| Q |
174 |
ttagttgcttactggtgtgaaaacagggtaatcttgagcagagaactgagaaacaggggaaggagatggaaatctagctttagctgggcctggacttggg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42072635 |
ttagttgcttactggtgtgaaaacagggtaatcttgagcagagaactgagaaacaggggaaggagatggaaatctagctttagctgggcctggacttggg |
42072536 |
T |
|
| Q |
274 |
cttgg |
278 |
Q |
| |
|
||||| |
|
|
| T |
42072535 |
cttgg |
42072531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 187 - 229
Target Start/End: Complemental strand, 24875128 - 24875086
Alignment:
| Q |
187 |
ggtgtgaaaacagggtaatcttgagcagagaactgagaaacag |
229 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24875128 |
ggtgtgaaaacagggtaatcatgagcagagaactgagaaacag |
24875086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University