View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0688_high_35 (Length: 283)
Name: NF0688_high_35
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0688_high_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 30 - 240
Target Start/End: Original strand, 40330478 - 40330689
Alignment:
| Q |
30 |
tactatggctgctatactatgtctatgatcatgttacacaagtaatagttattgtgtctttgattattttaaaatagtaactatttttgtaactgctttt |
129 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40330478 |
tactatggctgctaaactatttctatgatcatgttacacaagtaatagttaatgtgtctttgattattttaaaatagtaactatttttgtaactgctttt |
40330577 |
T |
 |
| Q |
130 |
taaattagc-nnnnnnnnngtctatgatcatgttactcaagttaatagtttacaacatcaaataccaattatcaacaatagcattaaacaaattgttttc |
228 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40330578 |
taaattagcttttttttttgtctatgatcatgttactcaagttaatagtttacaacatcaaataccaattatcaacaatagcattaaacaaattgttttc |
40330677 |
T |
 |
| Q |
229 |
taattgttgacc |
240 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40330678 |
taattgttgacc |
40330689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University