View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0688_high_49 (Length: 252)
Name: NF0688_high_49
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0688_high_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 29 - 240
Target Start/End: Original strand, 34567489 - 34567700
Alignment:
Q |
29 |
acctcgatctccgccggcctcgataacagaacaattccttccagttgtcgcgaaagttcggcttctatatcagttagtttagttttggcgtggtccactt |
128 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
T |
34567489 |
acctcgatctccgtcggcctcgataacagaacaattccttccagttgtcgcgaaagttcggcttctatatcagttagtttggttttggcgtggtcgactt |
34567588 |
T |
 |
Q |
129 |
cttcatgagtgggccgttcgccgataagtttgagaatggccctggcctgttgaacgtcgtcgatggccccggccatggcggcgattaattcgggatctgc |
228 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
34567589 |
cttcatgagtgggccgttcgccgataagtttgagaatggccctggcctgttgaacgtcgtcgatggcaccggccatggcggcgattaattcgggatctgc |
34567688 |
T |
 |
Q |
229 |
taggtttggcat |
240 |
Q |
|
|
|||||||||||| |
|
|
T |
34567689 |
taggtttggcat |
34567700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University