View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0688_high_53 (Length: 251)
Name: NF0688_high_53
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0688_high_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 8 - 238
Target Start/End: Complemental strand, 32059484 - 32059253
Alignment:
| Q |
8 |
cgaacaatatccattcttt-catgattccagtacaccaatctatcctcattcacttgcgggtacagcggtatatctaaaattctttgcgctgttccttct |
106 |
Q |
| |
|
|||| |||||||||||||| || ||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32059484 |
cgaataatatccattcttttcaggattccagtacaccaatttatcctcattcacttgtgggtacagcggtatatctaaaattctttgcgctgttccttct |
32059385 |
T |
 |
| Q |
107 |
acaaaaatatgccacacaagctatttgttccatgtttttgtgtcttagtgaatcaagtgacccacaaaatatctttgtaaagccaaagctgccggactca |
206 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32059384 |
acaaaaatatgccgcacaagctctttgttccatgtttttgtgtcttagtgaatcaagtgacccacaaaatatctttgtaaagccaaagctgccggactca |
32059285 |
T |
 |
| Q |
207 |
cgggaggtgtactagagctagcacccaaccaa |
238 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |
|
|
| T |
32059284 |
cgggaggcgtactagagctagcacccaaccaa |
32059253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 218 - 251
Target Start/End: Original strand, 32059188 - 32059221
Alignment:
| Q |
218 |
ctagagctagcacccaaccaaggctctcctatca |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32059188 |
ctagagctagcacccaaccaaggctctcctatca |
32059221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 207
Target Start/End: Original strand, 3300423 - 3300455
Alignment:
| Q |
175 |
atatctttgtaaagccaaagctgccggactcac |
207 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
3300423 |
atatctttgtaaagctaaagctgccggactcac |
3300455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University