View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0688_low_100 (Length: 206)
Name: NF0688_low_100
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0688_low_100 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 26 - 94
Target Start/End: Original strand, 34976693 - 34976761
Alignment:
| Q |
26 |
tgggggtattgtgaaaatggcattttcacccttcttcatggttttgataccttcatcccaccctatgat |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34976693 |
tgggggtattgtgaaaatggcattttcacccttcttcatggttttgataccttcatcccaccctttgat |
34976761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 85
Target Start/End: Original strand, 18848995 - 18849035
Alignment:
| Q |
45 |
gcattttcacccttcttcatggttttgataccttcatccca |
85 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
18848995 |
gcattttcacctttcttcatggttttaataccttcatccca |
18849035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University