View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0688_low_100 (Length: 206)

Name: NF0688_low_100
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0688_low_100
NF0688_low_100
[»] chr8 (1 HSPs)
chr8 (26-94)||(34976693-34976761)
[»] chr7 (1 HSPs)
chr7 (45-85)||(18848995-18849035)


Alignment Details
Target: chr8 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 26 - 94
Target Start/End: Original strand, 34976693 - 34976761
Alignment:
Q  26 tgggggtattgtgaaaatggcattttcacccttcttcatggttttgataccttcatcccaccctatgat 94  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  34976693 tgggggtattgtgaaaatggcattttcacccttcttcatggttttgataccttcatcccaccctttgat 34976761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 85
Target Start/End: Original strand, 18848995 - 18849035
Alignment:
Q  45 gcattttcacccttcttcatggttttgataccttcatccca 85  Q
    ||||||||||| |||||||||||||| ||||||||||||||    
T  18848995 gcattttcacctttcttcatggttttaataccttcatccca 18849035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University