View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0688_low_103 (Length: 201)
Name: NF0688_low_103
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0688_low_103 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 6e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 6e-42
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 33810180 - 33810286
Alignment:
| Q |
1 |
gtcatattgtgcccttagtttggatcgataataacatgaatataaacatgcaagtcctgtcatagccagtaacgccccataaattgttccatcacatgtg |
100 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33810180 |
gtcatattgtgccctcagtttggaccgataataacatgaatataaacatgcaagtccagtcacagccagtagcgccccataaattgttccatcacatgtg |
33810279 |
T |
 |
| Q |
101 |
caagctg |
107 |
Q |
| |
|
||||||| |
|
|
| T |
33810280 |
caagctg |
33810286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 33815089 - 33815195
Alignment:
| Q |
1 |
gtcatattgtgcccttagtttggatcgataataacatgaatataaacatgcaagtcctgtcatagccagtaacgccccataaattgttccatcacatgtg |
100 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |||| |||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
33815089 |
gtcatattgtgccctcagtttggaccgataataacatgaatataaacatgcaagtccagtcacagccagtagcgccccataaattgttccatcacaggtg |
33815188 |
T |
 |
| Q |
101 |
caagctg |
107 |
Q |
| |
|
||||||| |
|
|
| T |
33815189 |
caagctg |
33815195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University