View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0688_low_37 (Length: 349)
Name: NF0688_low_37
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0688_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 30414648 - 30414857
Alignment:
| Q |
1 |
taatagtttgtttgatgtatttgaatctgagataggtggggacgcctatttggttcagtatttggttcaggggaggtccatgtgaatagaaatgaccttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
30414648 |
taatagtttgtttgatgtatttgaatccgagataggtggggacgcctatt------------tggttcaggggaggtccatgtgaataggaacgaccttg |
30414735 |
T |
 |
| Q |
101 |
tagtagaattttccgctttgacaggaacgaggtggttcatggtatgtagtagaaggttgctatccatgtttacatgtcgttctgaggtctctttctcgtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30414736 |
tagtagaattttccgctttgacaggaacgaggtggttcatggtatgtagtagaaggttgctatccatgtttacatgtcgttttgaggtctctttctcgtg |
30414835 |
T |
 |
| Q |
201 |
aggtggtacaggaggtagaatc |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30414836 |
aggtggtacaggaggtagaatc |
30414857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University