View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0688_low_40 (Length: 341)
Name: NF0688_low_40
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0688_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 8e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 108 - 206
Target Start/End: Original strand, 11444731 - 11444829
Alignment:
| Q |
108 |
gtcctcaaactcaataattagaacaaagttgtggtattttttcacttttgataatgatgatacctattaaaaatggacttcaaattttaatagtagctt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11444731 |
gtcctcaaactcaataattagaacaaagttgtggtattttttcacttttgataatgatgatacctattaaaaatggacttcaaattttaatagtagctt |
11444829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 40 - 87
Target Start/End: Original strand, 11444670 - 11444717
Alignment:
| Q |
40 |
tgaagagataaatcggtgttagtgttttggtttagattggttttaggc |
87 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11444670 |
tgaagagataattcggtgttcgtgttttggtttagattggttttaggc |
11444717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University