View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0688_low_47 (Length: 310)

Name: NF0688_low_47
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0688_low_47
NF0688_low_47
[»] chr2 (1 HSPs)
chr2 (54-238)||(42822791-42822975)


Alignment Details
Target: chr2 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 54 - 238
Target Start/End: Original strand, 42822791 - 42822975
Alignment:
54 agatgaaaattaaggtcttcaaattggcctcttcataacaaatttctacaaattaaaattggatctatttcttgtcactttcaaaagaagcagtgtaaaa 153  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42822791 agattaaaattaaggtcttcaaattggcctcttcataacaaatttctacaaattaaaattggatctatttcttgtcactttcaaaagaagcagtgtaaaa 42822890  T
154 cactccaaagatgtaccataataaatagtaacgtaactaaaatctgctattcattgaatatgagaatatcttggacacccaaatt 238  Q
    ||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
42822891 cactccaaagatgtaccataataaatactaacgtaactaaaatctgatattcattgaatatgagaatatcttggacacccaaatt 42822975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University