View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0688_low_49 (Length: 307)

Name: NF0688_low_49
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0688_low_49
NF0688_low_49
[»] chr2 (1 HSPs)
chr2 (174-278)||(42072531-42072635)
[»] chr4 (1 HSPs)
chr4 (187-229)||(24875086-24875128)


Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 174 - 278
Target Start/End: Complemental strand, 42072635 - 42072531
Alignment:
174 ttagttgcttactggtgtgaaaacagggtaatcttgagcagagaactgagaaacaggggaaggagatggaaatctagctttagctgggcctggacttggg 273  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42072635 ttagttgcttactggtgtgaaaacagggtaatcttgagcagagaactgagaaacaggggaaggagatggaaatctagctttagctgggcctggacttggg 42072536  T
274 cttgg 278  Q
    |||||    
42072535 cttgg 42072531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 187 - 229
Target Start/End: Complemental strand, 24875128 - 24875086
Alignment:
187 ggtgtgaaaacagggtaatcttgagcagagaactgagaaacag 229  Q
    |||||||||||||||||||| ||||||||||||||||||||||    
24875128 ggtgtgaaaacagggtaatcatgagcagagaactgagaaacag 24875086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University