View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0688_low_51 (Length: 304)
Name: NF0688_low_51
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0688_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 3e-42; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 187 - 298
Target Start/End: Complemental strand, 17722809 - 17722698
Alignment:
| Q |
187 |
tagggccggaggtacagatcaaccgacgggacaactaggcttgtaacttgacggctaggattttgagattttagacttttgctctcaggcccactaatcg |
286 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||| | ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17722809 |
tagggccggcggtatagatcaaccgacgggacaactatgtttgtaacttgacggctagggttttgagattttagacttttgctctcaggcccactgatcg |
17722710 |
T |
 |
| Q |
287 |
tgagctctgatg |
298 |
Q |
| |
|
|||||||||||| |
|
|
| T |
17722709 |
tgagctctgatg |
17722698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 74 - 160
Target Start/End: Complemental strand, 17725188 - 17725102
Alignment:
| Q |
74 |
gacatcatcagacatgtagaagcgatgtgtggagggacaatagcaccgatatcctttttgaactcttgactggtctagaaagacaca |
160 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||| |
|
|
| T |
17725188 |
gacatcagcagacatgtagaagcgatgtgtggagggacaatagcaccgatatcctttttgaactcttgaatagcctagaaagacaca |
17725102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 187
Target Start/End: Complemental strand, 17724145 - 17724116
Alignment:
| Q |
158 |
acaaaaagaacattgtcaatatttaaagat |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17724145 |
acaaaaagaacattgtcaatatttaaagat |
17724116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 86; Significance: 4e-41; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 197 - 298
Target Start/End: Complemental strand, 13037417 - 13037316
Alignment:
| Q |
197 |
ggtacagatcaaccgacgggacaactaggcttgtaacttgacggctaggattttgagattttagacttttgctctcaggcccactaatcgtgagctctga |
296 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13037417 |
ggtatagatcaaccgacgggacaactaggtttgtaacttgacggctagggttttgagattttagacttttgctctcaggcccactgatcgtgagctctga |
13037318 |
T |
 |
| Q |
297 |
tg |
298 |
Q |
| |
|
|| |
|
|
| T |
13037317 |
tg |
13037316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 74 - 160
Target Start/End: Complemental strand, 13039793 - 13039707
Alignment:
| Q |
74 |
gacatcatcagacatgtagaagcgatgtgtggagggacaatagcaccgatatcctttttgaactcttgactggtctagaaagacaca |
160 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||| |
|
|
| T |
13039793 |
gacatcagcagacatgtagaagcgatgtgtggagggacaatagcaccgatatcctttttgaactcttgaatagcctagaaagacaca |
13039707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 187
Target Start/End: Complemental strand, 13038763 - 13038734
Alignment:
| Q |
158 |
acaaaaagaacattgtcaatatttaaagat |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13038763 |
acaaaaagaacattgtcaatatttaaagat |
13038734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 74 - 142
Target Start/End: Original strand, 11025843 - 11025911
Alignment:
| Q |
74 |
gacatcatcagacatgtagaagcgatgtgtggagggacaatagcaccgatatcctttttgaactcttga |
142 |
Q |
| |
|
||||||| || |||||||||||| ||| || || |||||||||||| ||||||||| | ||||||||| |
|
|
| T |
11025843 |
gacatcaacaaacatgtagaagctatgcgttgatggacaatagcacttatatcctttctaaactcttga |
11025911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University