View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0688_low_51 (Length: 304)

Name: NF0688_low_51
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0688_low_51
NF0688_low_51
[»] chr2 (3 HSPs)
chr2 (187-298)||(17722698-17722809)
chr2 (74-160)||(17725102-17725188)
chr2 (158-187)||(17724116-17724145)
[»] chr4 (3 HSPs)
chr4 (197-298)||(13037316-13037417)
chr4 (74-160)||(13039707-13039793)
chr4 (158-187)||(13038734-13038763)
[»] chr8 (1 HSPs)
chr8 (74-142)||(11025843-11025911)


Alignment Details
Target: chr2 (Bit Score: 88; Significance: 3e-42; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 187 - 298
Target Start/End: Complemental strand, 17722809 - 17722698
Alignment:
187 tagggccggaggtacagatcaaccgacgggacaactaggcttgtaacttgacggctaggattttgagattttagacttttgctctcaggcccactaatcg 286  Q
    ||||||||| |||| |||||||||||||||||||||| | ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||    
17722809 tagggccggcggtatagatcaaccgacgggacaactatgtttgtaacttgacggctagggttttgagattttagacttttgctctcaggcccactgatcg 17722710  T
287 tgagctctgatg 298  Q
    ||||||||||||    
17722709 tgagctctgatg 17722698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 74 - 160
Target Start/End: Complemental strand, 17725188 - 17725102
Alignment:
74 gacatcatcagacatgtagaagcgatgtgtggagggacaatagcaccgatatcctttttgaactcttgactggtctagaaagacaca 160  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||    
17725188 gacatcagcagacatgtagaagcgatgtgtggagggacaatagcaccgatatcctttttgaactcttgaatagcctagaaagacaca 17725102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 187
Target Start/End: Complemental strand, 17724145 - 17724116
Alignment:
158 acaaaaagaacattgtcaatatttaaagat 187  Q
    ||||||||||||||||||||||||||||||    
17724145 acaaaaagaacattgtcaatatttaaagat 17724116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 86; Significance: 4e-41; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 197 - 298
Target Start/End: Complemental strand, 13037417 - 13037316
Alignment:
197 ggtacagatcaaccgacgggacaactaggcttgtaacttgacggctaggattttgagattttagacttttgctctcaggcccactaatcgtgagctctga 296  Q
    |||| |||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||    
13037417 ggtatagatcaaccgacgggacaactaggtttgtaacttgacggctagggttttgagattttagacttttgctctcaggcccactgatcgtgagctctga 13037318  T
297 tg 298  Q
    ||    
13037317 tg 13037316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 74 - 160
Target Start/End: Complemental strand, 13039793 - 13039707
Alignment:
74 gacatcatcagacatgtagaagcgatgtgtggagggacaatagcaccgatatcctttttgaactcttgactggtctagaaagacaca 160  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||    
13039793 gacatcagcagacatgtagaagcgatgtgtggagggacaatagcaccgatatcctttttgaactcttgaatagcctagaaagacaca 13039707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 187
Target Start/End: Complemental strand, 13038763 - 13038734
Alignment:
158 acaaaaagaacattgtcaatatttaaagat 187  Q
    ||||||||||||||||||||||||||||||    
13038763 acaaaaagaacattgtcaatatttaaagat 13038734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 74 - 142
Target Start/End: Original strand, 11025843 - 11025911
Alignment:
74 gacatcatcagacatgtagaagcgatgtgtggagggacaatagcaccgatatcctttttgaactcttga 142  Q
    ||||||| || |||||||||||| ||| || || ||||||||||||  ||||||||| | |||||||||    
11025843 gacatcaacaaacatgtagaagctatgcgttgatggacaatagcacttatatcctttctaaactcttga 11025911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University