View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0688_low_53 (Length: 296)
Name: NF0688_low_53
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0688_low_53 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 75 - 239
Target Start/End: Original strand, 47885610 - 47885774
Alignment:
| Q |
75 |
attttggacagccgtcagtaaatcatttttattcagtgatttgacccattgttgaacattgctgtcgacttcccagaagatacaatgtccacgaatgtct |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47885610 |
attttggacagccgtcagtaaatcatttttattcagtgatttgacccattgttgaacattgctgtcgacttcccagaagatacaatgtccacgaatgtct |
47885709 |
T |
|
| Q |
175 |
atcttgtacttctgacacaagtctaacatatcatcagcatccttatagttgaaattccctctctg |
239 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47885710 |
atcttgtacttctgacacaagtccaacatatcatcagcatccttatagttgaaattccctttctg |
47885774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 100 - 234
Target Start/End: Complemental strand, 4623454 - 4623320
Alignment:
| Q |
100 |
tttttattcagtgatttgacccattgttgaacattgctgtcgacttcccagaagatacaatgtccacgaatgtctatcttgtacttctgacacaagtcta |
199 |
Q |
| |
|
||||||||||| || ||||||||||||||||| | | || |||||||| ||||| || ||||||||| | | ||||||||||||||||||||| || |
|
|
| T |
4623454 |
tttttattcagcgacttgacccattgttgaacggttccatccacttcccaaaagatgcagtgtccacgagtttggatcttgtacttctgacacaaggtta |
4623355 |
T |
|
| Q |
200 |
acatatcatcagcatccttatagttgaaattccct |
234 |
Q |
| |
|
| | ||||||||| || || || || ||||||||| |
|
|
| T |
4623354 |
aaagatcatcagcgtctttgtaattcaaattccct |
4623320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University