View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0688_low_59 (Length: 280)
Name: NF0688_low_59
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0688_low_59 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 8e-30; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 82 - 152
Target Start/End: Original strand, 25910127 - 25910197
Alignment:
Q |
82 |
tatttaaatcttaataataatgacttctaaaacaaatcaggttgcagcatgctgaaaaatatatgatgtat |
152 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
25910127 |
tatttaaatcttaataataatgacttctaaaacaaatcaggttgcagcatgctgaaaaatatatggtgtat |
25910197 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 152 - 183
Target Start/End: Original strand, 25910226 - 25910257
Alignment:
Q |
152 |
tataaaccatgtaccataagcaattgcttctt |
183 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
25910226 |
tataaaccatgtaccataagcaattgcttctt |
25910257 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University