View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0688_low_60 (Length: 280)
Name: NF0688_low_60
Description: NF0688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0688_low_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 25910070 - 25909887
Alignment:
| Q |
1 |
ggaattttggtcctcgtctcatttatgaatcannnnnnnctatgatgtggcatattgacaacacttattaggccacatttgtaaatcaccgtttcatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25910070 |
ggaattttggtcctcgtctcatttatgaatcacttttttctatgatgtggcatattgacaacacttattaggccacatttgtaaatcaccgtttcatgaa |
25909971 |
T |
 |
| Q |
101 |
ttcgaaattgttcaatccctagatagatgtttgtagtgcaattgtttggttcttctgcctctaatgttaggacttatacatatgatg |
187 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25909970 |
ttcgaaattgttcaatccttagatagatgtttgtactgcaattgtttgg---ttctgcctctaatgttaggacttatacatatgatg |
25909887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University